 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circOSBPL10 | |||
| Gene | OSBPL10 | Organism | Human |
| Genome Locus | Build | hg19 | |
| Disease | Gastric Cancer | ICD-10 | Stomach, Malignant neoplasm of unspecified (C16.9) |
| DBLink | Link to database | PMID | 31409903 |
| Experimental Method | |||
| Sample Type | Tissues | Comparison | A total of 70 paired GC samples |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GCTGGTGGTGTACTCTGCTAA ReverseCTCGAGGCTTCTGGTGTTTGC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Wang, S, Zhang, X, Li, Z, Wang, W, Li, B, Huang, X, Sun, G, Xu, J, Li, Q, Xu, Z, Xia, Y, Wang, L, Zhang, Q, Li, Q, Zhang, L, Chen, J, Wu, Y, Cao, J, Xu, P, Zhang, D, Xu, H, Xu, Z (2019). Circular RNA profile identifies circOSBPL10 as an oncogenic factor and prognostic marker in gastric cancer. Oncogene, 38, 44:6985-7001. | |||